Sol Genomics Network

Unigene SGN-U197263

Unigene Basic Information

Unigene ID:	SGN-U197263
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	197263
mRNA sequence:	Length: 580 bp

>SGN-U197263 Capsicum annuum #1 (3 members)
GCTTCGTGCCATGATAACTAAAGGCATGATTGAGCCTATTTCCAGTGTTTTCATTAACTTGGTTAATGCAGATTTCACCGCTAAACAAAG
GGGATTACAAATATCTGAAGAACGGATTCTCCTAGATGGTTCACCAGAAAGTCCAATTGAGTTCATTCAGGTTCAGATAGCCAATGTGGA
ATCCAAGTTTGCCAGTGCTATTTCTGATTCAGGAGAGATTAGAGTGGAAGGTAGAGTGAAGGATGGAGTTCCTCATTTGACAAAAGTTGG
ATCTTTTGAAGTGGATGTGAGCTTGGAAGGCAGTATCATTCTTTGCAGCCAGGTTGATCAACCAGGAATGATTGGAAAAGTGGGTAGCGT
CTTGGGTGAGGAGAATGTGAATGTCAGCTTCATGAGTGTTGGAAGGATTGCTCCTAGAAAGCAAGCTGTTATGGCTATTGGGGTGGATGA
ACAACCCACCAAGGACTCACTGAAGAAGATTGGCGAAATTCCTGCCATCCAGGAATCTGTTTCCCTTGGATTATAGGGTACTACAATTTT
TGGGATCTGATTCTTCATGAAACCATTTTGGTGATGCTGT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (2)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS10	Hairy root	2179	1
Capsicum annuum	KS11	Early root	2168	2

mRNA member sequences (3)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 2 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	207	2-Hacid_DH_C	71
2	22886	Ado_hcyase 2-Hacid_DH 2-Hacid_DH_C	18
5	57141	Ado_hcyase Sda_beta 2-Hacid_DH ACT 2-Hacid_DH_C PGDH	16
1.1	101571	D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding - Biological Process: L-serine biosynthesis (GO:0006564) - Molecular Function: oxidoreductase activity acting on the CH-OH group of donors NAD or NADP as acceptor (GO:0016616)	70
2	119461	D-3-phosphoglycerate dehydrogenase - Molecular Function: phosphoglycerate dehydrogenase activity (GO:0004617) - Biological Process: L-serine biosynthesis (GO:0006564) D-isomer specific 2-hydroxyacid dehydrogenase catalytic region - Biological Process: metabolism (GO:0008152) - Molecular Function: oxidoreductase activity acting on the CH-OH group of donors NAD or NADP as acceptor (GO:0016616) - Molecular Function: NAD binding (GO:0051287) Amino acid-binding ACT - Biological Process: metabolism (GO:0008152) - Molecular Function: amino acid binding (GO:0016597) D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding - Biological Process: L-serine biosynthesis (GO:0006564) - Molecular Function: oxidoreductase activity acting on the CH-OH group of donors NAD or NADP as acceptor (GO:0016616)	15
5	129795	D-3-phosphoglycerate dehydrogenase - Molecular Function: phosphoglycerate dehydrogenase activity (GO:0004617) - Biological Process: L-serine biosynthesis (GO:0006564) D-isomer specific 2-hydroxyacid dehydrogenase catalytic region - Biological Process: metabolism (GO:0008152) - Molecular Function: oxidoreductase activity acting on the CH-OH group of donors NAD or NADP as acceptor (GO:0016616) - Molecular Function: NAD binding (GO:0051287) Amino acid-binding ACT - Biological Process: metabolism (GO:0008152) - Molecular Function: amino acid binding (GO:0016597) D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding - Biological Process: L-serine biosynthesis (GO:0006564) - Molecular Function: oxidoreductase activity acting on the CH-OH group of donors NAD or NADP as acceptor (GO:0016616)	15

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: