Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.


This unigene is from an out-of-date build, Solanum tuberosum #2
It has been superseded by SGN-U289330 in the current build, Solanum tuberosum #4
Unigene SGN-U189953

Unigene Basic Information 
Unigene ID: SGN-U189953
Unigene Build: Solanum tuberosum #2
Date: 2003-12-04
Organism: S.tuberosum
Alternative ID: 189953
mRNA sequence: Length: 193 bp

>SGN-U189953 Solanum tuberosum #2 (1 members)
CCAACGGTAGACGGAGCCATGAAAAAAATGGGCAGCTTTGCCGTCGGCAGACCTGGCAATGGGAAAATGCCGTCGCCGGCGCCGCCGCGG
GTCTCGCCACTGTCACTTTCTCTCATCCACTTGACGTTGTTCGTACCAGGTTCCAAGTTTACGATGGAAGAATTTCCAATGTCCCCGCCT
ATAGGAACACACC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E479257
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None