Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U290313

Unigene Basic Information

Unigene ID:	SGN-U290313
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	290313
mRNA sequence:	Length: 737 bp

>SGN-U290313 Solanum tuberosum #4 (1 members)
TTCATTCCTCATGTTTCCATTTGAATGTTTGAGAAGCAGAGTGAAAAAAACTACAAGCAAATCATCGTACATTATCTGAGTAATACAGCA
GCGTGTGAGGTTCCCATATGTGCCACAAGAAGGGTGCAGATAAATTACATCTATGAGTGGAGTGGAACAGCTACAATGTTGTCGTAGGCT
CGATGGAATTTATACTAGGTACACAACACATAACAATTCGCGATACATACACATAATTAGTTGGAAATGTACATTGCTATTTCGCTTCAC
CACCAAAATAACTCAACTTCTGATGTTCACAGGACTGCATAAAGCAGTATGGAGAAAGGAGCAAACTTATGGATTGTCATGGGAGCATTC
TGTTAGTTCAGAACTCAACATGTGATGGAGGAGGAAATCTACTCGCTGGCTCCGAGTCTTAGTGCCAACATTACGTCTCCGCTCACTTGA
TTCCTTGTCATCACCATCCACACAGTTTGCTGCAGCCTCTAGATCCATTTCTGCTTGAAAAGCTTCCAAGACAAATGCTACAATCAAATT
TAACAGCCACAAAACTGAGATAAGATAGAAGCTGACGAAGTAGACATAAGTCCAGGCAGTCCCCGTTAGTTCCTTGTAGCTCTGCATCCA
CACTTGCCAATTTCCCATCACCAATATGTTGAAAACTGTGACCATGCCGCTTGGGTAGTCATTGAAGTTAAAAAGCAAATAGTCATTATC
AGAAAGCTCAGTTTGGG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E423626
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	2256	M+channel_nlg Ca/Na_pore Ion_trans Cat_channel_TrpL EF-hand	8
2	24523	M+channel_nlg Ca/Na_pore Ion_trans Cat_channel_TrpL EF-hand	8
5	59487	M+channel_nlg Ca/Na_pore Ion_trans Cat_channel_TrpL EF-hand	6
1.1	101407	Orn/DAP/Arg decarboxylase 2 - Molecular Function: catalytic activity (GO:0003824)	255
2	120789	Ion transport - Molecular Function: ion channel activity (GO:0005216) - Biological Process: ion transport (GO:0006811) - Cellular Component: membrane (GO:0016020) Cation (not K+) channel TM region - Molecular Function: cation channel activity (GO:0005261) - Biological Process: cation transport (GO:0006812) - Cellular Component: membrane (GO:0016020) Cation channel non-ligand gated - Molecular Function: cation channel activity (GO:0005261) - Biological Process: cation transport (GO:0006812) - Cellular Component: membrane (GO:0016020) Calcium-binding EF-hand - Molecular Function: calcium ion binding (GO:0005509) EF-Hand type - Molecular Function: calcium ion binding (GO:0005509) Ca2+/Na+ channel pore region - Molecular Function: cation channel activity (GO:0005261) - Biological Process: cation transport (GO:0006812) - Cellular Component: membrane (GO:0016020)	8
5	133771	Ion transport - Molecular Function: ion channel activity (GO:0005216) - Biological Process: ion transport (GO:0006811) - Cellular Component: membrane (GO:0016020) Cation (not K+) channel TM region - Molecular Function: cation channel activity (GO:0005261) - Biological Process: cation transport (GO:0006812) - Cellular Component: membrane (GO:0016020) Cation channel non-ligand gated - Molecular Function: cation channel activity (GO:0005261) - Biological Process: cation transport (GO:0006812) - Cellular Component: membrane (GO:0016020) Calcium-binding EF-hand - Molecular Function: calcium ion binding (GO:0005509) EF-Hand type - Molecular Function: calcium ion binding (GO:0005509) Ca2+/Na+ channel pore region - Molecular Function: cation channel activity (GO:0005261) - Biological Process: cation transport (GO:0006812) - Cellular Component: membrane (GO:0016020)	4

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U266805	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: