Sol Genomics Network

Unigene SGN-U272270

Unigene Basic Information

Unigene ID:	SGN-U272270
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	272270
mRNA sequence:	Length: 692 bp

>SGN-U272270 Solanum tuberosum #4 (11 members)
AGAAAATCCAAAAAAAGGAACAACTTTTCTTCAAGATTCAGAAAAAATGGCAGCAATAATCTCATCTGGTGCTGCTGTTACAACTCTTTC
TTTAACCTTCACACCAAAACCCATTTCATCATCTTCTTCTTCTTCTTCTTCTCCTTCACTGTTTGTTTCAACACCCAAGATTCAAACTTT
ATGTTCCTCTAGCTCACTTTTCTTCAACAGCAACAGTCAACTGTTTCTGGGTCCTCCAAGAACCACAAGAAAAGTAAGGAGCAACAGCAA
AAGAGGTCTTTCTTGTTACTGTTTATTTGGACTTGGAGTCCCTGAGCTGGCGGTGATTGCTGGTGTTGCTGCTCTTGTTTTTGGGCCCAA
ACAGTTACCTGAAGTTGGCCGCACTATTGGCAAGACTGTCAAGAGTTTCCAACAGGCTGCAAAGGAGTTTGAAACTGAGTTGAGAAAGGA
ACCCGATGCCTCTGCTCAGCCCCCAGTCGAAAAGGCCATTGAGGGAAGTCAAGAAGAGAAGCAAGACACAAAGGTTTCAAGCACCAAGGA
GAGTTCATAAAACCATAAATGCAGTTTGCCTCTAGCTATAGCTTCTAGGCTTTTACTATTTCTACAACACGATTGTTTCTTGTATTTGAC
AAGTTGTGTTGAGCTATTGTGTTTATTAATTTACATTCCTGGGTTTTCCCTCAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (6)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	CSWB	Tubers	6124	1
Solanum tuberosum	MXFL	Floral buds	6603	1
Solanum tuberosum	MXLF	Leaves	6585	2
Solanum tuberosum	STM	mixed tissues	14805	2
Solanum tuberosum	TUBS	Tubers	5976	4
Solanum tuberosum	cSTB	leaves and petioles 8 weeks old plants	10327	1

mRNA member sequences (11)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 6 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1800	TatA_E TatB MttA_Hcf106	10
2	26304	TatA_E TatB MttA_Hcf106	5
5	61122	TatA_E TatB MttA_Hcf106	4
1.1	102724	Bacterial sec-independent translocation protein mttA/Hcf106 - Molecular Function: protein transporter activity (GO:0008565) - Biological Process: protein transport (GO:0015031) Twin-arginine translocation protein TatA/E - Biological Process: protein transport (GO:0015031) - Cellular Component: integral to membrane (GO:0016021) Twin-arginine translocation protein TatB - Biological Process: protein secretion (GO:0009306) - Molecular Function: protein translocase activity (GO:0015450) - Cellular Component: membrane (GO:0016020)	11
2	121894	Twin-arginine translocation protein TatA/E - Biological Process: protein transport (GO:0015031) - Cellular Component: integral to membrane (GO:0016021) Twin-arginine translocation protein TatB - Biological Process: protein secretion (GO:0009306) - Molecular Function: protein translocase activity (GO:0015450) - Cellular Component: membrane (GO:0016020) Bacterial sec-independent translocation protein mttA/Hcf106 - Molecular Function: protein transporter activity (GO:0008565) - Biological Process: protein transport (GO:0015031)	6
5	132096	Twin-arginine translocation protein TatA/E - Biological Process: protein transport (GO:0015031) - Cellular Component: integral to membrane (GO:0016021) Twin-arginine translocation protein TatB - Biological Process: protein secretion (GO:0009306) - Molecular Function: protein translocase activity (GO:0015450) - Cellular Component: membrane (GO:0016020) Bacterial sec-independent translocation protein mttA/Hcf106 - Molecular Function: protein transporter activity (GO:0008565) - Biological Process: protein transport (GO:0015031)	6

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U253576	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: