Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U586021

Unigene Basic Information

Unigene ID:	SGN-U586021
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 1148 bp

>SGN-U586021 Tomato 200607 #2 (101 members)
GGCGATTGGCGGCCAAATCGGCCGAATATAAGAGGCGCCTCCTGCAGCCATTTCTCCATCTCTCTCAGCAGAGTCCAGCCAGCCATGGGT
ATCGATCTGAAGGCCGGAGGTAAGAGTAAGAAGACTAAGCGTACCGCCCCTAAGTCTGACGATGTTTACCTCAAGCTCCTCGTCAAGCTT
TACCGATTCTTGGCAAGGAGGACCGGAAGCAAGTTCAATGCGGTGATACTTAAGAGGCTCTTCATGAGCAAGATTAACAAGCCTCCACTT
TCTCTCTCGAGGTTGATTTCTTATGCTGAAGGAAAGGGCGATAAGACTGTTGTCCTTGTGGGAACTGTTACCGACGATGTTAGGGCTTAT
GAAGTTCCAAAATTGAAGGTGTGTGCTTTGAAGTTCACAAAGACAGCCAGGGCAAGGATTGAGAAGGCTGGGGGCGAATGCTTGACATTC
GATCAGTTGGCTCTCAGGGCTCCACTTGGACAGAACACGCTTCTCCTCAGAGGTCCAAAGAATGCACGTGAAGCAGTGAAGCACTTTGGT
CCAGCTCCAGGTGTTCCACACAGCCATACCAAACCATATGTGCGTGCCAAGGGAAGAAAGTTTGAGAGAGCTAGAGGAAAGAGGAAGAGC
AGGGGTTACAAGGCTTAAGTTGATTTCTATTATTTATCTCAGAATGGTTGTTATTTGTATCGTGGCAGTACAAGTTTTGCAGACTCTAGT
ATGCAGTTGCTTATGTTTGCTCCCGTCTTGTTGAGAATACTTTATTTTTATCTACTTTGAAACCAACTTTTAGTTTAAAATGATTGTGGT
GCATCAGTTTATTGTTGAGCAAAAATCATATAATATGACTAGTTGTTACACATTCCCCATCCTCGTGTTCTATGGATTGGGTTGTTTGGA
ATTGCCAGCTCAAGCGTAGGGATTCCATTTGTTTGTTTGGCTTTCTCTTCCTAAGCTATAGATCAATCCTCAAGTCTCCGTTTACAATAG
TATATCTGCACTGCTTCACTTCTTGTCACTGAAATCAACGACCACTTGCCTCCGTATTTTACTTCTTGACTGAAATACTCTGCCTTTGGG
TTTGTTACTGTGGTACATCCTCGCCTTTCACATTTACTGTACAATTATGTGTTAATTTGATGTTTTGA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
Solyc01g099900	Solyc01g099900

Genomic locations (0)

None

Library representation (34)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	3
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	6
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	7
Solanum lycopersicum	LA	Leaf Mature leaves	6589	1
Solanum lycopersicum	LB	Leaf Mature leaves	3316	5
Solanum lycopersicum	LE15	Fruit 15 days post anthesis	269	1
Solanum lycopersicum	Le2TR	roots 1-,2-,3-, and 4- month-old	1179	3
Solanum lycopersicum	LeMiToFr02	fruit	18697	1
Solanum lycopersicum	LeMiToLf01	leaf	30679	4
Solanum lycopersicum	LeTrich01	Isolated leaf trichomes Apical internodes of 5-week old plants.	7299	3
Solanum lycopersicum	LeWCAD	Seedling Two-week-old seedings	227	1
Solanum lycopersicum	SSH_3DPA	flower 3 days after Anthesis	252	2
Solanum lycopersicum	Sl_RootInf01	root and collar Three weeks old	385	1
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	3
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	3
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	1
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	18
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	3
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	2
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	3
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	2
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	2
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	3
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	3
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	4
Solanum lycopersicum	cTOS	suspension cultures	8026	3
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	5

mRNA member sequences (101)

Alignment image suppressed for unigene with 101 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (1)

Unigene	Build
SGN-U312837	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: