| Unigene Basic Information |
| Unigene ID: | SGN-U625520 |
| Unigene Build: | Coffea canephora #3 |
| Date: | 2010-04-15 |
| Organism: | C.canephora |
| Alternative ID: | none |
| mRNA sequence: | Length: 100 bp |
>SGN-U625520 Coffea canephora #3 (1 members)
TTTTGGAGGGGCTTTGTCAGAGGACCCTTGCAGCTAATACAAGCATGAATTTTCGTGATTTTTTGGTCTTTATGATGCGTTTTGCTTTTG
CCAACTTGTT
[Blast] [AA Translation]
| Associated Loci (0) |
| Genomic locations (0) |
Library representation (1)
|
mRNA member sequences (1)
|
To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)
|
Expression Data (0)
|
Annotations (manual: 0 | blast: 0 | go: 0 )
|
Protein prediction analysis (3)
|
| Gene Family (0) |
Preceding Unigenes (1)
|
Library representation (1)
Library representation (1)

