Unigene SGN-U625520

Unigene Basic Information 
Unigene ID: SGN-U625520
Unigene Build: Coffea canephora #3
Date: 2010-04-15
Organism: C.canephora
Alternative ID: none
mRNA sequence: Length: 100 bp

>SGN-U625520 Coffea canephora #3 (1 members)
TTTTGGAGGGGCTTTGTCAGAGGACCCTTGCAGCTAATACAAGCATGAATTTTCGTGATTTTTTGGTCTTTATGATGCGTTTTGCTTTTG
CCAACTTGTT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (3)  
Gene Family (0)None
Preceding Unigenes (1)