This unigene is from an out-of-date build, Coffea canephora #2
It has been superseded by SGN-U614458 in the current build, Coffea canephora #3
Unigene SGN-U357313

Unigene Basic Information 
Unigene ID: SGN-U357313
Unigene Build: Coffea canephora #2
Date: 2007-05-18
Organism: C.canephora
Alternative ID: 357313
mRNA sequence: Length: 126 bp

>SGN-U357313 Coffea canephora #2 (1 members)
GACTACGTTTTTTCCAAACTTTTTTGGGATCCAATAATTCACCACCTGATCAATGCATTCCTGAAATTGCGTACTTTATTATACAGCAGC
ATGTTGAAGCTCCTTCAATGTGGTCAATTTTTCCTG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)