Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U597959 in the current build, Tomato 200607 #2

Unigene SGN-U346911

Unigene Basic Information

Unigene ID:	SGN-U346911
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	346911
mRNA sequence:	Length: 592 bp

>SGN-U346911 Tomato 200607 #1 (1 members)
GGGGACAAGGAGACCAAAGAGGATCTGAAAACTGTAGCATTGGGTACGTCAAAGATCAACTACCTTGATCCCAGAATAACAGTTGCATGG
TGCAAGCGGCATGAAGTACCTATTGAGAAGATATTCAACAAGTCACTTCTGGCCAAGTTTGCTTGGTCCATGGATGTTGATCCTAGCTTC
AGATTCTGATGCTTTGGTGGCTGTGGTAGCTCCTGGACCCCCCACTCCCCATCTCTCTCCTGTATCCCCCAACGACTGCAAAGAAAGGAG
AAACCAAGAATTCCCGGGGAAAAAGACATGGAACCTTCAACTAATCTCTCTTACAATATTTTATTCATTCATGCTGTATGGAAAGTGTCG
TTAACGAAGTTTTGGGGTCAGTTCCCATCTTTCACTTTATTTTTCATTGAGCGAAGGTGTTAAAACGGAACTCTGACAAGCCCCCTGCTG
CTACTTGTGGTAGGCAAGGCATTTGAGTTTTACAAATGTATTACTCATTTAGCTTTCAATTAGTTTCGCTTTCGGGGATTGGATAGTTTT
GGCTGGGATATTTATTGTTAGTTGAAAATGTATTTAAATCGAGTCGATCTTG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cTSC	seed	2256	1

mRNA member sequences (1)

To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 5 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101515	Protein of unknown function DUF1216	92
2	120850	DNA topoisomerase I C-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase type I activity (GO:0003917) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase I DNA binding eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase type I activity (GO:0003917) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase I C-terminal eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA breaking-rejoining enzyme catalytic core - Molecular Function: DNA binding (GO:0003677) DNA topoisomerase I catalytic core eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268)	8
5	131096	DNA topoisomerase I C-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase type I activity (GO:0003917) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase I DNA binding eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase type I activity (GO:0003917) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA topoisomerase I C-terminal eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268) DNA breaking-rejoining enzyme catalytic core - Molecular Function: DNA binding (GO:0003677) DNA topoisomerase I catalytic core eukaryotic-type - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA topoisomerase (ATP-hydrolyzing) activity (GO:0003918) - Cellular Component: chromosome (GO:0005694) - Biological Process: DNA topological change (GO:0006265) - Biological Process: DNA unwinding during replication (GO:0006268)	8

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U236639	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: