This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been superseded by SGN-U572285 in the current build, Tomato 200607 #2
Unigene SGN-U167904

Unigene Basic Information 
Unigene ID: SGN-U167904
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 167904
mRNA sequence: Length: 170 bp

>SGN-U167904 Lycopersicon Combined #2 (1 members)
CTGAATTATAAATGTTTTCTACAGAACAATTAGTTACATTTTTATGGCATGGTATTCAACTTACAGCTCTCATCTTCAAGTTTTTGACTG
TTGAGTTTGAGCAACAACAAACATTACTCAATATATCTCCTAAATTTACTTAATAAAAAGAACAAGTAGATTGGTTTCTG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  


To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None