EST details — SGN-E833814

Search information 
Request: 833814Match: SGN-E833814
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C665789Clone name: CC-F01_014_C19.scf
nocartOrdering Not Available
Library Name: irdccfOrganism: Coffea canephora

Tissue: Cherry of different developmental stages
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E833814Length: 330 bp (704 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E833814 [] (trimmed) taggctttgacgatatttgtgcatatgatttctagtgctgaaccacatgagagccgccgcagctcgggtgttgtcattctccccaatagtgttgg
gatgtgccttgtcctcattgatagctttaacttattatgtccatagtacaatgtagctttctccccctactggaatttgtagttttgcaactcat
tttctaagattgctgtttcactttcatacttcaagaattttttggttttcatattggcaaaatattgttctctcgttcaaggactgacattagcc
cttgttcagaactaaattgtacaacattaatgtgtacattttcac
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E833814] SGN-U615119 Coffea canephora Build 3 2 ESTs assembled
[SGN-E833814] SGN-U634431 Coffee species Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T665878 [Download][View] Facility Assigned ID: CC-F01_014_C19
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: