EST details — SGN-E821053
Search information |
Request: 821053 | Match: SGN-E821053 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C646911 | Clone name: TT-38_M05.abi |
| ||
Library Name: TT | Organism: Nicotiana tabacum |
Tissue: Trichomes and senescent leaf
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E821053 | Length: 114 bp (190 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E821053 [] (trimmed)
aacgtatctatataaatttacacttgatttatctttactagagaaactttatgtaatacttccacttattgcaattatgttttgtatccaaatat
attgaatgagaaattctat
attgaatgagaaattctat
Unigenes |
Current Unigene builds | |||||
[SGN-E821053] | SGN-U498143 | Nicotiana tabacum | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T647000 [Download][View] | Facility Assigned ID: TT-38_M05 |
Submitter: None | Sequencing Facility: ATCsub |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |