EST details — SGN-E812792

Search information 
Request: 812792Match: SGN-E812792
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C640975Clone name: TL13.110F03F.060320T7.scf
nocartOrdering Not Available
Library Name: TL13Organism: Nicotiana tabacum

Tissue: Leaf
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E812792Length: 456 bp (920 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E812792 [] (trimmed) gccattacggccggggtgaaatcaatagaagcaaacaaaccatcaggtgcaaaaggagtttactggaagagtgcacatgtatgttcatctatggg
gccatccattcggttaaacgtaagggagatgctcgagtacaagcttccgaacgcataattgacctacacatgtatattgcatcttctgccatctc
cgccgctgattctccggcacctgttccggcttccgttgccaccatcttcgtccccaccttcttcgcttcgtttgttgctcttgcttttgctcttc
tcttctaatttagctccatgtattcttgattaaatcatgagggtcgtttcgtaatttcattattttgttttgttttgttttggagtgactctttg
attgtattttgttagtttcatgtatttttgtgtaatatatttgaaattttagtgagtttttaggttattgctactg
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E812792] SGN-U472507 Nicotiana tabacum Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T641064 [Download][View] Facility Assigned ID: TL13.110F03F.060320T7
Submitter: None Sequencing Facility: ATCsub
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: