EST details — SGN-E798546

Search information 
Request: 798546Match: SGN-E798546
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C626821Clone name: KR2B.113J09F.060128T7.scf
nocartOrdering Not Available
Library Name: KR2BOrganism: Nicotiana tabacum

Tissue: Roots
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E798546Length: 436 bp (852 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E798546 [] (trimmed) attacggccggggttaacatttgaagagtatgcgaggtcgtgggagcagaacgaggagttgggtcttaatgacatggacacaacctcggctgatg
ctgcttacggttcagcagatgctgcacccagtgagagagctgacaattgatgaatttgtgcttagcggttttcttttatactgctctggccttaa
aatctataaggtttgagcttccttttgccccccatggagttctgtttcttcaagtgatgaaatcaccttgattagattttgtgtattggtctttc
ctttagctttgtagttgtaaaatttccaagttattgtttccttttacctttggacatgtacaacctcattccaccagtgttgattatgaatgtca
aattatcatacacttatttcttgtattaatgcaaaattatatgtactttattggct
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E798546] SGN-U478081 Nicotiana tabacum Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T626910 [Download][View] Facility Assigned ID: KR2B.113J09F.060128T7
Submitter: None Sequencing Facility: ATCsub
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: