EST details — SGN-E798457
Search information |
Request: 798457 | Match: SGN-E798457 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C626927 | Clone name: KR2B.113E23F.060128T7.scf |
| ||
Library Name: KR2B | Organism: Nicotiana tabacum |
Tissue: Roots
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E798457 | Length: 125 bp (238 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E798457 [] (trimmed)
attacggccggggtgatatatacatagatgacttcattgagtatcttcataagaacaaaagcctttgtattgattaatgagagtggatcatcaaa
aataaatgttcatctatttattcgacctgt
aataaatgttcatctatttattcgacctgt
Unigenes |
Current Unigene builds | |||||
[SGN-E798457] | SGN-U462068 | Nicotiana tabacum | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T627016 [Download][View] | Facility Assigned ID: KR2B.113E23F.060128T7 |
Submitter: None | Sequencing Facility: ATCsub |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |