EST details — SGN-E795150

Search information 
Request: 795150Match: SGN-E795150
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C624764Clone name: KR2B.102P02F.051227T7.scf
nocartOrdering Not Available
Library Name: KR2BOrganism: Nicotiana tabacum

Tissue: Roots
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E795150Length: 271 bp (932 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E795150 [] (trimmed) attacggccgggtgatgaagaatgcagtgttttgggaagttgcttgaggctgatccgaacaatgtattgtacaatagaggaggaagaaaacactg
tatatatgatatctcccgtctgtctctgtagaaacgaacaaatagcatctttgtaagttatttagataagcaccaatcatagttgtactatactt
ggcaaggttgccgtatgccatgtttatgcttccatagatgctatctctctatctataaatactgctgctcttttgaagccg
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E795150] SGN-U494629 Nicotiana tabacum Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T624853 [Download][View] Facility Assigned ID: KR2B.102P02F.051227T7
Submitter: None Sequencing Facility: ATCsub
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: