EST details — SGN-E794644
Search information |
Request: 794644 | Match: SGN-E794644 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C625313 | Clone name: KR2B.101I05F.060128T7.scf |
| ||
Library Name: KR2B | Organism: Nicotiana tabacum |
Tissue: Roots
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E794644 | Length: 191 bp (310 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E794644 [] (trimmed)
attacggccggggatacaccataagtacccaaaaaaatataaataaataagggatgcgtgacagttcatcaatggcagctctgcagtctggcact
gggttttatcttcttcctctctcttgaatctagattaatgttgctttagattactgcagttttctatgtataaaaaaatataactattaaattca
t
gggttttatcttcttcctctctcttgaatctagattaatgttgctttagattactgcagttttctatgtataaaaaaatataactattaaattca
t
Unigenes |
Current Unigene builds | |||||
[SGN-E794644] | SGN-U486219 | Nicotiana tabacum | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T625402 [Download][View] | Facility Assigned ID: KR2B.101I05F.060128T7 |
Submitter: None | Sequencing Facility: ATCsub |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |