EST details — SGN-E793950
Search information |
Request: 793950 | Match: SGN-E793950 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C617809 | Clone name: KP1B.113K09F.060117T7.scf |
| ||
Library Name: KP1B | Organism: Nicotiana tabacum |
Tissue: Seedling
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E793950 | Length: 276 bp (857 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E793950 [] (trimmed)
attacggccggggatgcttcagatggagatgatgctggggcaaatgggaatggagggcatgatgatgattcagatgatgaaaatgacgatgagga
cgatgaagaggatgatgatgaggatgacgaggaagaagagaatcaaccaccatataagaagaaaaagtgagatcatactacattttatatgattc
cgagattaatttggtagggtaaaagattctagtgaaatctttaccattaagtcaatgtcaatggttcttatctgtttcgatgatgg
cgatgaagaggatgatgatgaggatgacgaggaagaagagaatcaaccaccatataagaagaaaaagtgagatcatactacattttatatgattc
cgagattaatttggtagggtaaaagattctagtgaaatctttaccattaagtcaatgtcaatggttcttatctgtttcgatgatgg
Unigenes |
Current Unigene builds | |||||
[SGN-E793950] | SGN-U453965 | Nicotiana tabacum | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T617898 [Download][View] | Facility Assigned ID: KP1B.113K09F.060117T7 |
Submitter: None | Sequencing Facility: ATCsub |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |