EST details — SGN-E768659

Search information 
Request: 768659Match: SGN-E768659
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C591048Clone name: KF8C.110A21F.051216T7.scf
nocartOrdering Not Available
Library Name: KF8Organism: Nicotiana tabacum

Tissue: Flowers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E768659Length: 274 bp (930 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E768659 [] (trimmed) attacggccgggggaagaattatagtaaggtagttcactggttatattagctgatgatgatataaatagcaaatggaagctagctttagaacagg
atctgctcaaataagttggggatccatccatccaacaacttgctagtttgttaaaatctttggggtagcggcaataatctttgtagattagacaa
atcaactagtgttgtatatagtgtttgttaaataaaattctgtaacttgctattaatgctggataatgtatttccgatatctcg
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E768659] SGN-U503907 Nicotiana tabacum Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T591137 [Download][View] Facility Assigned ID: KF8C.110A21F.051216T7
Submitter: None Sequencing Facility: ATCsub
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: