EST details — SGN-E751846
Search information |
Request: 751846 | Match: SGN-E751846 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C578912 | Clone name: BL12.101F05F.060309T7.scf |
| ||
Library Name: BL12 | Organism: Nicotiana tabacum |
Tissue: Leaf
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E751846 | Length: 101 bp (248 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E751846 [] (trimmed)
gccattacggccggggaattttgacattatactcaggagcgtagttttaatacattcagacgaagttgcataacttattttgaggccacaaaagg
ctgtgc
ctgtgc
Unigenes |
Current Unigene builds | |||||
[SGN-E751846] | SGN-U503420 | Nicotiana tabacum | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T579001 [Download][View] | Facility Assigned ID: BL12.101F05F.060309T7 |
Submitter: None | Sequencing Facility: ATCsub |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |