SGN ID: SGN-C495768 | Clone name: FC17DA11 |  | Order Clone |
|
Library Name: FC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E722602 | Length: 160 bp (1420 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E722602 [] (trimmed)
GGCGATTGGCGGCCAATCGGCCGAATTGTTTAATATTATGTATTATGAAATTGTGTTCTTATGCATAATCAAAACTTAAAAGGCGGGAAAGTCGA
ACAGGTTCATCGTGAAACAATTTGATTTTCTCTTTGCTTGCAAGAATGTTATCAGTTATGGTGTT
[BLAST] [AA Translate]
SGN-ID: SGN-T520936 [Download][View] |
Facility Assigned ID: FC17DA11.f
|
Submitter: None |
Sequencing Facility: Kazusa2 |
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.841 |
Expected Error Rate: 0.0040 |
Quality Trim Threshold: 20.5 |