Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E721497

Search information 
Request: 721497Match: SGN-E721497
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C494663Clone name: FC14AD07
cartOrder Clone
Library Name: FCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E721497Length: 442 bp (1438 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E721497 [] (trimmed) GGCGATTGGCGGCCAATCGGCCGAATTGATAACAAAGTATCATGAATTCAATAAAATATTTATCCATTTTATTCATCATCTTATATATATCAACA
TCAACGGTTGATAGCTTTATTAATCGTTGGGAAGTTCATATAATTAATGATCTACCAAATAATGATATACCTCTATGGTATCATTGTGCATCCGG
AGATACAGATTTTGGATATCATATTCTTAAAGTGGGCGAAGATTTTCATTTTGAATTTAGAGTGAATATTCCTTTAATGTCCACACTATACTTTT
GTCATTTTTGGTGGGGTATTAATCAAAACGTATTCGATGTTTTTAATAAAAACTTGATGCTACATATTTGTTCTAATGAAGGTGATAAGGTCCAT
AATTGTTTCTGGAAAGTAGAAAAAGATGGATTTTTTGCTGGTCCTGGATTTTATGAAGTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E721497] SGN-U593272 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T522551 [Download][View] Facility Assigned ID: FC14AD07.f
Submitter: None Sequencing Facility: Kazusa2
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.903 Expected Error Rate: 0.0011 Quality Trim Threshold: 20.5