Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E720824

Search information 
Request: 720824Match: SGN-E720824
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C493990Clone name: FC11DH03
cartOrder Clone
Library Name: FCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E720824Length: 524 bp (1191 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E720824 [] (trimmed) GACCACACAACTTTCTTCTTCTGCTCATCAATTAGCAATTAATCCAAAACCATTATGGCTGCCAAAAATTCAGAGATGAAGTTTGCTATCTTCTT
CGTTGTTCTTTTGACGACCACTTTAGTTGATATGTCTGGAATTTCGAAAATGCAAGTGATGGCTCTTCGAGACATACCCCCACAAGAAACATTGC
TGAAAATGAAGCTACTTCCCACAAATATTTTGGGACTTTGTAACGAACCTTGCAGCTCAAACTCTGATTGCATCGGAATTACCCTTTGCCAATTT
TGTAAGGAGAAGACGGACCAGTATGGTTTAACATACCGTACATGCAACCTGTTGCCTTGAACAATATCAATGATCTATCGATCGATCTATCTATC
TATTTATCTGTCTCTGCGCGTATAGTGTTGTCTGTACCTTTGGTGTGAAGAATATGAATAAAGGGATACATATATCTAGATATATTCTAGGTAAT
GTCCTATTGTATTTAAAATTTGTAGCAATGATTGTTTGAATAAAAACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E720824] SGN-U580902 Tomato 200607 Build 2 583 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T522801 [Download][View] Facility Assigned ID: FC11DH03.f
Submitter: None Sequencing Facility: Kazusa2
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5