Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E719789

Search information 
Request: 719789Match: SGN-E719789
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C492955Clone name: FC08DE08
cartOrder Clone
Library Name: FCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E719789Length: 456 bp (1376 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E719789 [] (trimmed) GGGCGATTGGCGGCCAATCGGCCGAATTGACAGCACATTATCGTCCTTACAGTGGTTATGGCCATGGTTACCATGGCCTTGGCTACGGTTACGGC
CATGGCCACGGCTATGGTTATAGTCGTGGCCATGACTACTATAACACAATGCCAATGAGTCCATACAATTATTCAATGAGAAGATCCATGACGAT
GGAGCAACCTCACTACTATGGTCATCATGCTTCTTCATATCCTAGGTATCGGCCATTTTACTATTAATTATTTTATCAAGGAATATGCTGAAATG
AATTATGGAACGCTATGCTTTAATGTTGATTTAACTAGCCAGAGTTTTGTGAGCCAAAAAGCTTGAATTACAATATTTCGAGAGTAATGATAAGA
TTGTGATCAATATTAATTAAGGGTAAAGGATATTTTTATAGCCTATCCCAAATAACATTTTACAGTATGATTCACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E719789] SGN-U579585 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T523613 [Download][View] Facility Assigned ID: FC08DE08.f
Submitter: None Sequencing Facility: Kazusa2
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0008 Quality Trim Threshold: 20.5