EST details — SGN-E695493

Search information 
Request: 695493Match: SGN-E695493
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468659Clone name: LH_Ea06K19
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468659 [LH_Ea06K19] Trace: SGN-T495837 EST: SGN-E691653 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E695493Length: 365 bp (1090 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E695493 [] (trimmed) TTTTTTTTTTTTTTTTTTTCACTTTTTTTTGGGGAACAATTAAAAAATATATATATAGTTAGCAAACATCATATTCCCTGGCTTTGTCAAAACAA
TTAGAGGATCCTTTTCTAAAATTGGCCCAACCCCGGGGAACCTTTCAAAACAAAAGCCTCTTTTTTTAAAAAAAACAAAACCTTGTTCTGGCTGG
ATGATGCTAATTTCCCCAAAGGGAACTTTTGAGCAACCCCCCAAGGACAAAAATACCCAAAAAATTGGGTTTCTTGGAATGTTAAACAAAAAAAA
ACCCTCCCCTTCCCTTCGGGGGTTCCCTAACCGTTTCCACTGGTTGGCTGGTGCTTCAACCCAACCCCCCAAAACGCCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E695493] SGN-U604701 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T491922 [Download][View] Facility Assigned ID: LH_Ea06K19.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.896 Expected Error Rate: 0.0324 Quality Trim Threshold: 14.5