Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E694481

Search information 
Request: 694481Match: SGN-E694481
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C467647Clone name: LH_Ea04A15
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C467647 [LH_Ea04A15] Trace: SGN-T497234 EST: SGN-E690641 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E694481Length: 201 bp (1077 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E694481 [] (trimmed) TTTTTTTTTTTTTTTTTTAAAGATTAATATCTGATTGATCTACTTCATAAAGAATCACAATACAAAATTAGTTATAAGAAAGAGACCTTTACTGC
GAAATCAGTTCACTAAGAAGAGATCCATTGTCTCGATTGGAAAGGTAAAACCTAAACCCTCGTTCCTTGTACATCTATACTTCACCTTCTCGAGG
AATTTATTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E694481] SGN-U566166 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T493015 [Download][View] Facility Assigned ID: LH_Ea04A15.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.907 Expected Error Rate: 0.0338 Quality Trim Threshold: 14.5