Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E694468

Search information 
Request: 694468Match: SGN-E694468
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C467634Clone name: LH_Ea04A02
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C467634 [LH_Ea04A02] Trace: SGN-T497247 EST: SGN-E690628 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E694468Length: 193 bp (1066 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E694468 [] (trimmed) TTTTTTTTTTTTTTTTTTAAGAAAAAACTTCATTACATAAAGCAACTTTTAAGACACAACAAGTTCATGATTGAACCTTAGTTTTGCCTTTAGAG
GGGGAAAAAAAGCAATATCTAGCTGTTTTTACCTTTGCTTTGACATAGGATTTAACTAGTAAAGATCACTCTCCCCTCGTGCCGAATTCGGCACG
AGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E694468] SGN-U589326 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T493028 [Download][View] Facility Assigned ID: LH_Ea04A02.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0185 Quality Trim Threshold: 14.5