Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E694171

Search information 
Request: 694171Match: SGN-E694171
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C467337Clone name: LH_Ea03D17
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C467337 [LH_Ea03D17] Trace: SGN-T496982 EST: SGN-E690331 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E694171Length: 380 bp (1108 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E694171 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTAGTAAAGGAAAGAATCGGCTAAATCCATTATAGTTCTTTCATGAACGCACAAAGAAGAAGGTGGGATCAA
CGTTTCCCTAGTGTTTAATAAACAAACACCTTGGAATACTTTGACTGTGTTATTTAATAATACAATAATAAAAACTAACAAGTTTTGTGTAATGC
AGAGTTCTCCATACTTAGTGATACACAATCCTGTGTTAAACTAACACATAACCCATTTTCAGTAAGCATTTTTAAGTGTGATACTTCATCCATTT
CAGGCTACAATCTGGTATCATAAAACAAGACTGCCAACCAGCACTGAGGTTAAGGGAACTGTTAAGTTATCATCGAGTTCACTACTTAAAGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E694171] SGN-U583081 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T493319 [Download][View] Facility Assigned ID: LH_Ea03D17.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0169 Quality Trim Threshold: 14.5