Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E693510

Search information 
Request: 693510Match: SGN-E693510
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C466676Clone name: LH_Ea01I04
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E693510Length: 255 bp (1160 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E693510 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTGCCCTCAAAACAATGGACACTTATAAGAAGCGCGTATGGACATTATGATGCAACTAGTCCCCTTAAAATACT
AAATATGAATCTTGGTGAAACAAAATATTACATCCCCCTAGTGATTGGCTAAAGAGTATGACTGGATTACAAAAATTTCCATTTGAGTACTCTTC
CCGGGATTGATTCTATGTAAATCATGACCTAGGCCGCAACAGCTAAGTTAACAAGAGCAAACGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E693510] SGN-U599200 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T493975 [Download][View] Facility Assigned ID: LH_Ea01I04.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0281 Quality Trim Threshold: 14.5