EST details — SGN-E693111
Search information |
Request: 693111 | Match: SGN-E693111 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C470117 | Clone name: LH_Ea10H13 |
| ||
Library Name: LH_Ea | Organism: Solanum habrochaites (formerly Lycopersicon hirsutum) |
Tissue: Glandular Trichomes
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E693111 | Length: 179 bp (1106 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E693111 [] (trimmed)
CCTCGTGCCGAATTCGGCACGAGGCTGCCTCCTTGTGTTTCTGTATGATACTGTCTAGTAAAATGCAATTATTTTTATGACTTTGGGGACAGACC
TGAGAACAAGGGTTTGATATTCAAGTTACTTCAGTTTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
TGAGAACAAGGGTTTGATATTCAAGTTACTTCAGTTTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Unigenes |
Current Unigene builds | |||||
[SGN-E693111] | SGN-U586746 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T494319 [Download][View] | Facility Assigned ID: LH_Ea10H13.f |
Submitter: Eyal Fridman | Sequencing Facility: AGI |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.864 | Expected Error Rate: 0.0008 | Quality Trim Threshold: 12.5 |