EST details — SGN-E683077
| Search information |
| Request: 683077 | Match: SGN-E683077 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C433769 | Clone name: cccwc22w20i17 |
| ||
| Library Name: cccwc22w | Organism: Coffea canephora |
Tissue: Whole Cherry
Development Stage: 22 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E683077 | Length: 57 bp (1303 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E683077 [] (trimmed)
CACACAAATGAGTACTGTCGCACCAATGGCCCAGGAACCTGTCACCCGACCGACTTC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E683077] | SGN-U614063 | Coffea canephora | Build 3 | 19 ESTs assembled | |
| [SGN-E683077] | SGN-U636641 | Coffee species | Build 1 | 74 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T457632 [Download][View] | Facility Assigned ID: cccwc22w20i17.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
