EST details — SGN-E680896

Search information 
Request: 680896Match: SGN-E680896
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C431591Clone name: cccwc22w4a17
nocartOrdering Not Available
Library Name: cccwc22wOrganism: Coffea canephora

Tissue: Whole Cherry
Development Stage: 22 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E680896Length: 195 bp (1253 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E680896 [] (trimmed) GCTCTGTTGTTGTGGTTGTAATTTGTGAGTTTCAGTGGTAATAAGAACGGAAAGAGAGGTACGAGAGAGGATGGGAAGAGGTAGGGTGGAGCTAA
AGACGACAGACACCATGATCACTCCGCAAGTAACTTTTCCTAAGCGACTCCCTGAGCTATTGCAGAAATCTTATCCGCTCTCACCTCTGTATGAT
GCTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E680896] SGN-U620241 Coffea canephora Build 3 1 ESTs assembled
[SGN-E680896] SGN-U640742 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T455454 [Download][View] Facility Assigned ID: cccwc22w4a17.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15