EST details — SGN-E673351

Search information 
Request: 673351Match: SGN-E673351
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C462019Clone name: cccs46w27n23
nocartOrdering Not Available
Library Name: cccs46wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 46 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E673351Length: 330 bp (1527 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E673351 [] (trimmed) GCAGACATGTCTAATGTTAGTTCTGACGCAGCCAAAGCCATCAGTAAGGAAATGCCGGTTGAACTCTTGCGAGCTAGTCTCCCTCATACCAGTGA
GCAACAAAGAAAGCTGCTATTGGATTTTGCACAGCAGTCAATGCCTGTTCAAGGGTTAGGTAATCAGGGTGGTGATAGTGGTGGCCCTTGAGTGT
AACATGTTATTGCGAGGCTTCACATATAGCTAAAGACATGCTGGAAGACATGCCAGTGATTGTGCAATGAGGGATTAGGTTTTTTCCTTTTTTCT
TTTTTCTTCCTTTTTTTTTTTAGGGGGGGGGGGGGTTAGTGGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E673351] SGN-U626146 Coffea canephora Build 3 1 ESTs assembled
[SGN-E673351] SGN-U642887 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T485882 [Download][View] Facility Assigned ID: cccs46w27n23.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15