EST details — SGN-E666327
| Search information |
| Request: 666327 | Match: SGN-E666327 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C456899 | Clone name: cccs46w12n19 |
| ||
| Library Name: cccs46w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 46 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E666327 | Length: 67 bp (985 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E666327 [] (trimmed)
ACCTTTCTTGTGAGGAAGGAGATCCTCTCTTATGCGACTTTTCAGGTAATTATTATATGTAGTTCTC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E666327] | SGN-U617268 | Coffea canephora | Build 3 | 4 ESTs assembled | |
| [SGN-E666327] | SGN-U637506 | Coffee species | Build 1 | 4 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T480762 [Download][View] | Facility Assigned ID: cccs46w12n19.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
