EST details — SGN-E663669
| Search information |
| Request: 663669 | Match: SGN-E663669 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C454511 | Clone name: cccs46w12d3 |
| ||
| Library Name: cccs46w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 46 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E663669 | Length: 123 bp (1015 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E663669 [] (trimmed)
GGAAGGAAAATAGGAGCTTTTTCAAAAACAGGGTCTTCCCCCCCTTGCCAAAAAACTACAAAGGGGGGGGGCCCATAACAAAACCCCCGATCGGG
GGTTTTTTATAAAACCACTTGGGATGGG
GGTTTTTTATAAAACCACTTGGGATGGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E663669] | SGN-U615790 | Coffea canephora | Build 3 | 2 ESTs assembled | |
| [SGN-E663669] | SGN-U634745 | Coffee species | Build 1 | 2 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T478374 [Download][View] | Facility Assigned ID: cccs46w12d3.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
