EST details — SGN-E656718
| Search information |
| Request: 656718 | Match: SGN-E656718 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C405500 | Clone name: cccl24j19 |
| ||
| Library Name: cccl | Organism: Coffea canephora |
Tissue: LeafB
Development Stage: Young
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E656718 | Length: 233 bp (1030 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E656718 [] (trimmed)
AATTTGGAGTCGGTCAATTAGTTCGGTCTTTCACAAAGCTGTGATCCATTTTATGTTGCTCATCTGTTTAGCAGTTCAAGTACTTTTTTTTAAGG
TCAGGATTGAAGTCTCTAAATAATGAGAATGATTTAGTGGAGTAGTTATCCGCAGTTCAGTCTCCGGTGGTATTTCAGCAAGGACAATGATGGCT
TTTCTCGTATTTCCTCTTGTTGTCAAATCTGAAACTCTCATGC
TCAGGATTGAAGTCTCTAAATAATGAGAATGATTTAGTGGAGTAGTTATCCGCAGTTCAGTCTCCGGTGGTATTTCAGCAAGGACAATGATGGCT
TTTCTCGTATTTCCTCTTGTTGTCAAATCTGAAACTCTCATGC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E656718] | SGN-U619874 | Coffea canephora | Build 3 | 55 ESTs assembled | |
| [SGN-E656718] | SGN-U635236 | Coffee species | Build 1 | 121 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T429363 [Download][View] | Facility Assigned ID: cccl24j19.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
