Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E651454

Search information 
Request: 651454Match: SGN-E651454
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C402014Clone name: cccl7p4
nocartOrdering Not Available
Library Name: ccclOrganism: Coffea canephora

Tissue: LeafB
Development Stage: Young

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E651454Length: 89 bp (1009 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E651454 [] (trimmed) CTCCCCCTTATGCCCACACTCCCACAAAGACGTATAAGGATCTCAGAAGCTATTCAGATCATCAGCAAGTTATCTCCTTCTCCAAACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E651454] SGN-U628286 Coffea canephora Build 3 1 ESTs assembled
[SGN-E651454] SGN-U631939 Coffee species Build 1 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T425877 [Download][View] Facility Assigned ID: cccl7p4.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15