EST details — SGN-E650613

Search information 
Request: 650613Match: SGN-E650613
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C450469Clone name: cccs30w32k5
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E650613Length: 114 bp (1005 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E650613 [] (trimmed) TGAAATTTCTCCAGATGCTGATGTAGTAAAGGAGGAACTATTTGCTCCTGTTCTCTATGTTATGAAATTTCAGACGCTGAAGGAAGCTATAAAAA
TAAACCACTCCGTACCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E650613] SGN-U622162 Coffea canephora Build 3 1 ESTs assembled
[SGN-E650613] SGN-U638812 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T474332 [Download][View] Facility Assigned ID: cccs30w32k5.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15