EST details — SGN-E649120
| Search information |
| Request: 649120 | Match: SGN-E649120 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C448976 | Clone name: cccs30w34b4 |
| ||
| Library Name: cccs30w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E649120 | Length: 40 bp (987 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E649120 [] (trimmed - flagged)
GCAAGCATTAAGGAAAAAAAAATGGGTGATTAGTGCAAAA
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T472839 [Download][View] | Facility Assigned ID: cccs30w34b4.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Possibly chimeric (anomalous insert into vector) |
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |


