Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E644386

Search information 
Request: 644386Match: SGN-E644386
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C444242Clone name: cccs30w25g15
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E644386Length: 37 bp (1023 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E644386 [] (trimmed - flagged) CGGCAAGAAGCCCCCCTCGGAGGGAATTGAAAGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T468105 [Download][View] Facility Assigned ID: cccs30w25g15.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15