EST details — SGN-E644386
Search information |
Request: 644386 | Match: SGN-E644386 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C444242 | Clone name: cccs30w25g15 |
| ||
Library Name: cccs30w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E644386 | Length: 37 bp (1023 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E644386 [] (trimmed - flagged)
CGGCAAGAAGCCCCCCTCGGAGGGAATTGAAAGAAAA
Unigenes |
Current Unigene builds | |||||
No current unigene builds incorporate this sequence |
Chromatogram |
SGN-ID: SGN-T468105 [Download][View] | Facility Assigned ID: cccs30w25g15.i |
Submitter: None | Sequencing Facility: Cornell |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Problems: | Possibly chimeric (anomalous insert into vector) |
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |