EST details — SGN-E625597

Search information 
Request: 625597Match: SGN-E625597
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C438116Clone name: cccs30w6a21
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E625597Length: 297 bp (668 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E625597 [] (trimmed) GAAGGAAGACACTTGACCCATCTGGTAAAGATCACACCATTATCTTGGTACTGCCATCAGGAATATACCATTACAAGTTTATTGTTGATGGCAGT
GTGAAATATATCCCAAATCTTCCATATGAAGCTGATGGCATGGGGCATGTTTGCAATCTTCTTGATGTTCATGAGGATGTCCCGGAGAACTTCGA
AGGTGTGAGGGAGTTTGAAGCGCCACCATTTTTTGACACGAGCTATAGTCATAGTTTTCTTAGTGATGAAGATTTTGCAAAGGACCCAGTGGAAG
TTCCACCTCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E625597] SGN-U620429 Coffea canephora Build 3 1 ESTs assembled
[SGN-E625597] SGN-U639879 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T461979 [Download][View] Facility Assigned ID: cccs30w6a21.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15