EST details — SGN-E621672

Search information 
Request: 621672Match: SGN-E621672
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C398335Clone name: 72030
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E621672Length: 267 bp (414 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E621672 [] (trimmed) TTTTTTTTTTGCAATGAAAAATATATATTACAATAAAAATTCTGGTTTATCACAAAGTTTTCTTTAAAATAATTCATCATCAATTTAATCCATCT
CTTGTGGACTTGTGATCAGATGACATAAGTTTGTATGGTTTTCAATATGGTGTCAGGATCCATAGTAGCATCAACCTTAAGTATCCCTTCTGCTT
CATCAATCTGAAGTAAATCCAGTTGGGTCTGCAAGAGCTTTGCAGGCATGAAATGCTTTCCTCAGCTGCTCTCTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E621672] SGN-U297104 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T422198 [Download][View] Facility Assigned ID: bf_mxflxxxx_0049d04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5