Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E621052

Search information 
Request: 621052Match: SGN-E621052
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C398065Clone name: 71759
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E621052Length: 277 bp (535 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E621052 [] (trimmed) CAATCAAATTCCTGGAGAAGCTCTAAGATAAGCGTATCAGAACTCCTCTTCTCCAACCTGGAAATCCTCTTCCATCAAAAACTGAATTAACAATG
GTCATTCCAGGTGAATCAGAATGAGCAAGGAAGTAGGGATGATTATTATTGAGTGTGGTGTTGACATTGACCTGAGGATCAGGGACCTGTTGAGG
GGTGTTATCTCCCATTTTACTGTTAGCTTAAGAGAGGATTTGAAAAGAAGATTGGATCGAGCTATTGCTCTGATACCATGAAAGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E621052] SGN-U290540 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T421928 [Download][View] Facility Assigned ID: bf_mxflxxxx_0042a03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0191 Quality Trim Threshold: 20.5