Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E606907

Search information 
Request: 606907Match: SGN-E606907
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C383740Clone name: 22862
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E606907Length: 257 bp (806 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E606907 [] (trimmed) GTTTCTTTTTTTTTTTTTTCTTTGCTCTCTCAACTAGATCCTCAAAAATAAGCTGTAGATTAACATCGTGAATGGATGGGGAACCAATTCCCTCA
AAAATTGCAACTTTAAAGTCTTCAAATGTCCATGTTGATGAGATCGTGATCTTTTCTGACTTAACTACATCTTTTACACGAATCTTGTCTTCATG
ATACTGTTTTTCCAACTCTTCAGTGACGTCTTCAAACAAATCCTTCGGTGTTGAACCAGAAGTATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E606907] SGN-U296641 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T407603 [Download][View] Facility Assigned ID: bf_tubsxxxx_0022e09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0027 Quality Trim Threshold: 12.5