EST details — SGN-E606661

Search information 
Request: 606661Match: SGN-E606661
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C383494Clone name: 22609
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E606661Length: 226 bp (1111 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E606661 [] (trimmed) GAGGATTATTTCTACTCAAACCCATGGGAGTGTTTAGAATCATCTAATGAGGATGAAACACTAAGTAGCAGCATTTAAATCATGTTGGTACAACA
TATGGTCAGAAGAAAAAAAACACACTTCCACGCTGTTTCTGTGAATGATTTATAGAAGATAGCTCTCAACACACTGAGTCAGTGAGAAAGCAGGA
TTTTGCTTCAATGCAGCTCTTGAAGTGCACCCTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E606661] SGN-U298001 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T407357 [Download][View] Facility Assigned ID: bf_tubsxxxx_0019d10.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5