EST details — SGN-E605892
| Search information |
| Request: 605892 | Match: SGN-E605892 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C382725 | Clone name: 21823 |
| ||
| Library Name: TUBS | Organism: Solanum tuberosum |
Tissue: Tubers
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E605892 | Length: 178 bp (950 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E605892 [] (trimmed)
ATTCACAACCTACACTGGTGGTATATGTCATTACAGAGTCGGTGACATACTCCAGGTCACGCGGTTTCACAACTCTGCCCCTCAGTTTAAATTCA
TAATAAGGAAAAATGTGCTATTGAGAGTTGATTCGGACAAAACTGATGAGGCTGAGTTGCAAAACGCGGTTGATAGCGCTGCT
TAATAAGGAAAAATGTGCTATTGAGAGTTGATTCGGACAAAACTGATGAGGCTGAGTTGCAAAACGCGGTTGATAGCGCTGCT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E605892] | SGN-U293323 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T406588 [Download][View] | Facility Assigned ID: bf_tubsxxxx_0011c03.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.970 | Expected Error Rate: 0.0090 | Quality Trim Threshold: 12.5 |


