EST details — SGN-E594320

Search information 
Request: 594320Match: SGN-E594320
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C371333Clone name: 37569
nocartOrdering Not Available
Library Name: CSWBOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E594320Length: 286 bp (655 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E594320 [] (trimmed) CTACTTGATAGTTAACTGTTTTGCTAAGTATGTAGGATTCGATGTTGCTAGGTTTGATCACGAGTTCGAGCTATGGAATCAATCCTTGATGTTTG
TGTTAGGGTAGTTGTCTACATTACACCCCCCCCCCCCCTTATGGTACAGTCCTTCCACGTATCCTACATAATAGCGGGAATGCTTTGAGCACCAG
ACTGTCCCAACATTGGTGTTTTGGTTTTGTAATGGCAAGTGATTCTTGAATATGCTACTGTTATTTGTAGTAATATAATAGCTATTTAATATGAA
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E594320] SGN-U290669 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T395196 [Download][View] Facility Assigned ID: bf_cswbxxxx_0020e04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0069 Quality Trim Threshold: 12.5