EST details — SGN-E581116

Search information 
Request: 581116Match: SGN-E581116
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C358988Clone name: 6359
nocartOrdering Not Available
Library Name: ACDAOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E581116Length: 324 bp (942 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E581116 [] (trimmed) TTGCATCTCGCCATACGATTTTCATGTGCATCAATGGTCAACATGATGTTTCTCTACTCTAGACCGCTTTTACCAGAAATGCATTATGTGAAGCC
ATTGTCTGTAACGCAGCAAGATATGCTGCGACATCGAGCTGTAAATATTGTGGCTGCAAGGCTAAGCCGTGCAGAACCTCCTCTCAGAAAAGAAG
TTGTTGAATACATGAGTGATGCAGATGCACACCTCTGGAGCATGAGGCGCAGCAGAGCGAACTTTTTCAGACTGATGTCTGTCTTTAGTGGATTA
CTCTCTGTTGGGAACTGGTTCGGAGATGTATGCATGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E581116] SGN-U295718 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T381992 [Download][View] Facility Assigned ID: ACDA01122F06.T3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0286 Quality Trim Threshold: 20.5