EST details — SGN-E579420

Search information 
Request: 579420Match: SGN-E579420
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C356440Clone name: 86548
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E579420Length: 217 bp (938 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E579420 [] (trimmed) CGTCTCTGTAAGCTGCTTCAACAAAGACTCCTTACAAAGAGAAGAATGCTTGGGCCATTCCCCTTGGATCTGCCGCATATCATGCATCAACTGAT
ACAAGCTTGTTCTCTAGCTCATTTGCCTGTGCTACCTCATGCGAAATTTAAACTTCAATGAGTCCGAGCACTATGGTCAATCCATTGATGATAGC
TCACCTAGCTTAAGCAAGCTTCAATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E579420] SGN-U296164 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T380296 [Download][View] Facility Assigned ID: bf_stolxxxx_0064b09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0305 Quality Trim Threshold: 14.5