EST details — SGN-E577828
| Search information |
| Request: 577828 | Match: SGN-E577828 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C354933 | Clone name: LE08AA09 |
| ||
| Library Name: LE08 | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Fruit
Development Stage: 8 days post anthesis
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E577828 | Length: 209 bp (786 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E577828 [] (trimmed)
TTAATTCTAACCACCTCCTTTGTATGAGATTTAGTTCCTTCTGAGTGAACACATACTGGAGGCTTTTGTGATCACTGATTATGTCAACATGAATA
CCATACAAGTAGTTACATCATATCTTCAAAGCAAACACTACTTCAACTTTCCAAGTCACTTATTCAATAAGATCCTTACCATATCTCTTAACGAA
AAGACTCGAGGGGGGGCCC
CCATACAAGTAGTTACATCATATCTTCAAAGCAAACACTACTTCAACTTTCCAAGTCACTTATTCAATAAGATCCTTACCATATCTCTTAACGAA
AAGACTCGAGGGGGGGCCC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E577828] | SGN-U598611 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T378929 [Download][View] | Facility Assigned ID: LE08AA09 |
| Submitter: Virginie Garcia | Sequencing Facility: PRI |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.922 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 12.5 |
Working
