EST details — SGN-E567778
| Search information |
| Request: 567778 | Match: SGN-E567778 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C345009 | Clone name: 11956 |
| ||
| Library Name: STOL | Organism: Solanum tuberosum |
Tissue: Stolon
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E567778 | Length: 185 bp (1020 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E567778 [] (trimmed)
AGCTTCAGGGAAATCAACTTAGGCATTATAACTGTAAATAGTATTTGATGTGTACACAACTTAAAATCGATTGTTCACATTGACTGAGCCAATTT
GCAGTTTTTGTAAATGCTTGTTCACTATGATTGATAAGACTCTCAACTATTAAACAAATATCTCGATATCTCGAAAAAAAAAAAAAAAAA
GCAGTTTTTGTAAATGCTTGTTCACTATGATTGATAAGACTCTCAACTATTAAACAAATATCTCGATATCTCGAAAAAAAAAAAAAAAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E567778] | SGN-U273800 | Solanum tuberosum | Build 4 | 3 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T368780 [Download][View] | Facility Assigned ID: bf_stolxxxx_0012c12.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.915 | Expected Error Rate: 0.0072 | Quality Trim Threshold: 12.5 |


